circad | circRNAs associated with diseases

circRNA-chr19
Gene	ZNF536	Organism	Human
Genome Locus	chr4:144464661-144465125:+	Build	hg19
Disease	Ebola virus disease	ICD-10	Ebola virus disease (A98.4)
DBLink	Link to database	PMID	29209594
Experimental Method
Sample Type	Cell Lines	Comparison	293T cells with and without transcription and replication-competent virus-like particle (trVLP) infection
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GGCATAGTCACAGTGCGGAC Reverse CAGCCTTTAACGGACTTGCA	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wang, ZY, Guo, ZD, Li, JM, Zhao, ZZ, Fu, YY, Zhang, CM, Zhang, Y, Liu, LN, Qian, J, Liu, LN (2017). Genome-Wide Search for Competing Endogenous RNAs Responsible for the Effects Induced by Ebola Virus Replication and Transcription Using a trVLP System. Front Cell Infect Microbiol, 7:479.